КОНСТРУИРОВАНИЕ БИБЛИОТЕКИ ГЕНОВ, КОДИРУЮЩИХ ИММУНОЛОГИЧЕСКИ ЗНАЧИМЫЕ БЕЛКИ ВИРУСА АЧС ИЗОЛЯТА KRASNODAR 06/12 Варенцова А.А.,Шевченко И.В.,Зиняков Н.Г.,Власова Н.Н.,Груздев К.Н.,Дрыгин В.В.

Федеральное государственное бюджетное учреждение «Федеральный центр охраны здоровья животных», г. Владимир


Номер: 5-1
Год: 2014
Страницы: 28-35
Журнал: Актуальные проблемы гуманитарных и естественных наук

Ключевые слова

африканская чума свиней, иммунодоминантные белки, секвенирование, клонотека генов, African swine fever, immunodominant proteins, sequence, gene library

Просмотр статьи

⛔️ (обновите страницу, если статья не отобразилась)

Аннотация к статье

Статья посвящена созданию клонотеки и анализу нуклеотидных последовательностей генов B646L (p72), CP204L (p30), KP177R (p22), O61R (p12), EP402R (CD2v), CP530R (pp62), CP2475L (pp220) и E183L (p54) вируса африканской чумы свиней. Нуклеотидные последовательности генов B646L (KJ195685), CP204L (KJ195684), KP177R (KJ380912), O61R (KJ380913), EP402R (KJ195682), CP530R (KJ380911), CP2475L (KJ195683) и E183L (KJ380910) вируса АЧС изолята Krasnodar 06/12 опубликованы в базе данных GenBank впервые.

Текст научной статьи

I. Введение С 2007 года на территории Российской Федерации (РФ) регистрируют вспышки африканской чумы свиней (АЧС) и на протяжении 6 лет страна является зоной стационарного неблагополучия по данному заболеванию [1;2]. Возбудитель АЧС - крупный ДНК-содержащий оболочечный вирус диаметром приблизительно 200 нм. Наружный слой вириона представляет липопротеидная оболочка, приобретаемая почкованием в процессе выхода из клетки. Под ней находится капсид икосаэдрической формы, затем внутренняя липидная оболочка, в которую заключен кор вируса. [4;20]. Кор окружает электронно-плотный нуклеоид, который содержит двухцепочечную ДНК размером около 200 тыс.п.о. [3] На настоящий момент определены полные нуклеотидные последовательности 13 изолятов вируса АЧС (по данным GeneBank на 2013 год). Первая полноразмерная нуклеотидная последовательность была определена для изолята, адаптированного к росту в перевиваемой культуре клеток BA71V. Буквенное обозначение генов вируса АЧС дано в зависимости от их местоположения во фрагментах генома, полученных в результате рестрикционного расщепления по сайту узнавания рестриктазы EcoRI. Геном содержит 151-167 открытых рамок считывания (ОРС) и различается по длине ОРС и количеству генов в мультигенных семействах. Уменьшение длины генома наблюдается также как результат варьирования количества тандемных повторов в пределах генов или интергенных регионов [17]. Проведенные зарубежными учеными исследования подтвердили активное воздействие вируса на основные этапы внутриклеточного синтеза [5]. Структурные белки, синтезируемые при репликации вируса АЧС, активно воздействуют на репродукцию клеточных белков и перестраивают работу ферментативного аппарата клетки на синтез вирусных белков, нуклеиновых кислот и ферментов. Существует также группа белков, супрессирующая синтез иммуноглобулинов и снижающая активность Т-клеток [7]. Работы по изучению протеинов вируса АЧС показали, что поверхностные белки р30, p54, p22, CD2v, и p12 играют значительную роль в процессах вирус-клеточного взаимодействия, а синтез белков рр220, рр62 и р72 активно воздействует на морфогенез вируса. Основным капсидным белком является продукт гена B646L р72, при участии которого происходит проникновение вируса в клетку. Этот белок синтезируется на поздних стадиях инфекции и локализуется между двумя слоями липопротеидной оболочки во внеклеточных вирусных частицах [20;21]. Структурный белок р22 (с молекулярной массой 22 kDa) расположен во внешней мембране вирусной частицы. Он содержит гидрофобный трансмембранный регион с сигнальным пептидом на N-конце. Обнаруживается на ранних этапах вирусной инфекции в плазматической мембране [8]. Белок р12, кодируемый геном O61R, является основным белком прикрепления, формирует димеры с молекулярной массой 17 кДа [9,10,11]. Анализ данных по изучению нуклеотидных последовательностей ДНК фрагмента, содержащего ген O61R, показал, что его 5’-концевой регион является практически идентичным у всех изученных вирусных изолятов, в то время как интергенный регион, расположенный далее за рамкой считывания гена, сильно варьирует у различных изолятов [12]. Ген EP402R кодирует белок CD2v, имеющий большое структурное и функциональное сходство с мембранным антигеном лимфоцитов CD2, который участвует в адгезии клеток и модуляции иммунного ответа. Установлено, что CD2v отвечает за способность вируса АЧС к гемадсорбции и играет важную роль в ускользании от воздействия эффекторов иммунной системы хозяина [13]. Фосфопротеин р30, кодируемый геном CP204L, является белком проникновения и выполняет регуляторную роль [14]. Установлена ведущая роль p30 на первых стадиях вирусной инфекции, так как антитела к p30 способны ингибировать процесс интернализации вируса в клетку [22]. Белок р54 является поздним белком и локализуется в вирусных фабриках, отвечает за прикрепление вируса АЧС к клетке хозяина. Его размеры варьируют между 24 и 28 кДа у различных вирусных изолятов. По данным Gomez-Puertas Р. еt al. (1996), гликопротеин р54, наряду с фосфопротеином р30, ответственен за формирование защитного иммунного ответа у иммунизированных свиней. Полипротеин рр220, кодируемый геном CP2475L, представляет собой N-миристилированный полипептид, который после протеолитического процессинга дает р150, р37, р34 и р14. Эти белки присутствуют в зрелых вирионах в эквимолярных количествах и составляют около 1/4 общей массы белков вирионов. Они являются основными компонентами коровой оболочки вириона вируса АЧС [16]. Результаты, представленные в работе Suares C. еt.al., (2010) доказали, что полипротеин pp62 играет существенную роль в сборке вириона вируса АЧС. Репрессия синтеза полипротеина рр62 оказывает существенное влияние на формирование кора в икосаэдрических вирионах [18]. Полипротеин рр62 находится в центре коровой оболочки нуклеоида, взаимодействуя с двумя противолежащими слоями полипротеина pp220 [19]. Выявлена четкая корреляция между количеством полипротеина рр62, количеством полипротеина pp220 и формированием кора вирионов. Низкий уровень полипротеинов рр62 и pp220 приводил к формированию полых вирионов, которые практически лишены геномной ДНК [19]. Данная работа посвящена созданию репрезентативной клонотеки генов вируса АЧС, кодирующих белки p72, p30, p22, p12, CD2v, pp62, pp220 и p54, которые участвуют в процессе формирования вириона, или являются белками прикрепления и проникновения. II. Материалы и методы Для выделения ДНК вируса АЧС использовали пробы 10% суспензии селезенки свиней, павших от АЧС, изолята Krasnodar 06/12. Общий пул ДНК экстрагировали фенольно-детергентным методом. Для получения и накопления ПЦР-продукта использовали: матричную ДНК с концентрацией 100 мкг/мл по 1 мкл на реакцию, Taq- и Pfu- ДНК-полимеразы, буфер с (NH4)2SO4, 2,5мМ MgCl2, смесь трифосфатов 10мМ, (Fermentas), праймеры, фланкирующие гены (по 10пМ каждого). Общий объем реакционной смеси 20 мкл. В работе были использованы следующие праймеры, приведенные в таблице 1. Таблица 1 Нуклеотидные последовательности праймеров, использованных для амплификации генов вируса АЧС Назва-ние гена Назва-ние прай-мера Последовательность 5’ - > 3’ Дли-на п.о. Сайты рестрик-таз Источник O61R Fp12/24 GCGGATCCTTGAATAAGCGTTAAC 24 BamHI Angulo A. et al., 1992 Rp12/25 GCGGATCCGACATCATTATGGATGA 25 BamHI CP2475L Fp220/26 TATGGTACCAATCATATAAGAATAAC 26 KpnI Andres G. et al., 2002 Rp220/27 CGGCGGCCGCGACCAGGACTGCTTCTC 27 NotI B646L Fp72/27 TATCAGGATCCTTCGCATAAACCGCCA 27 BamHI Neilan J.G. 2004 Rp72/27 GGAAGCCCACAGATCTAACCCATTGTG 27 BglII CP204L Fp30/28 AGAGGTTGAAGATCCATGGTTACCCATT 28 NcoI J.G. Neilan et al., 2004 Rp30/28 CTAATAAATCTGGATCCTGCTGCTGCAG 28 BamHI E183L Fp54/28 TTCTTGAGGATCCTTGGAAAGTTGGTCC 28 BamHI J.G. Neilan et al., 2004 Rp54/28 CTTATAATATACTGCAGTATGTTGAGTC 28 PstI KP177R Fp22/27 CAGAAAGGATCCAATATTATGTAGACC 27 BamHI J.G. Neilan et al., 2004 Rp22/29 CGATGCACAATATTATAAGCTTTAAACCG 29 HindIII CP530R pp62F ATAAGAATTCGATGCCCTCTAACATGAAA 29 EcoRI Казакова А.С, 19.01.2012 pp62R AGGAAGTCGACAGGTAAAACACACCACAG 29 SalI EP402R CD2vF2 ATAAAACGGATCCTGATAAAATGATAATAC 30 BamHI CD2vR2 TAGGAATTCTTAAATAATTCTATCTACGTG 30 EcoRI Температуру отжига праймеров подбирали постановкой реакции с градиентом температур от 42 до 62°С с шагом 1ºС на амплификаторе «Терцик» (ДНК-технологии, Россия). Учет результатов проводили методом электрофоретического разделения в 1,5%-ном агарозном геле с детектированием в УФ свете после окраски бромистым этидием. Для проведения секвенирования выделили ПЦР-продукт из агарозного геля с помощью набора реагентов для элюции ДНК из агарозных гелей (Fermentas). Web-ресурсы: для анализа нуклеотидных последовательностей генома штаммов и изолятов вируса АЧС использовали ресурсы международных баз данных NCBI, EMBL; сравнительный анализ гомологии нуклеотидных последовательностей генов проводили с помощью программ BioEdit 6.0.7 и MEGA 5.05. Клонирование ПЦР-продуктов проводили согласно руководству T. Maniatis [23] в прокариотическом векторе pJET1.2 с использованием клеток Е. coli штамма DH5α. III. Результаты и обсуждение Нуклеотидные последовательности используемых нами праймеров содержат в себе сайты рестрикции для дальнейшего клонирования в экспрессирующих плазмидах. Проведенный анализ расположения генов позволил определить места посадки праймеров на физической карте генома изолята Georgia 2007/1 вируса АЧС (Рисунок 1). Рис. 1. Схема полноразмерного генома вируса АЧС штамма Грузия 2007/1 с расположением ОРС генов B646L, CP204L, KP177R, O61R, EP402R, CP530R, CP2475L и E183L (стрелками указано направления считывания клонированных генов, а в скобках отмечены позиции их локализации) На основе предварительного анализа в ПЦР с диагностическими праймерами к р72FR и р12FR, были отобраны матрицы для оптимизации условий ПЦР и синтеза копий полноразмерных генов вируса АЧС. Поскольку в ранее проведенных исследованиях были оптимизированы условия синтеза для генов, кодирующих белки р72, р30, р54 (Казакова А.С., 2013), р12 и р22 (Варенцова А.А., 2011), то подбор режимов амплификации проводили только для генов, кодирующих белки CD2v, pp220 и pp62. Оптимизация условий синтеза проходила по подбору температурного режима отжига праймеров, концентрации ионов магния и количества циклов. В результате испытаний выбраны следующие режимы амплификации (таблица 2): Таблица 2 Режим амплификации полноразмерной копии генов O61R, EP402R, CP2475L и CP530R Параметры Кол-во циклов Температурный режим EP402R CP2475L CP530R Предварительный цикл 1 980С - 2 мин 980С - 2 мин 980С - 2 мин Денатурация Отжиг праймеров Элонгация 35 950С - 30 сек 470С - 30 сек 720С - 120 сек 950С - 30 сек 500С - 30 сек 720С - 120 сек 950С - 30 сек 550С - 30 сек 720С - 120 сек Завершающий цикл 1 720С - 5 мин 720С - 5 мин 720С - 5 мин Подобранные праймеры и оптимизированные условия амплификации (таблица 2) позволили получить полноразмерные копии генов, пригодные для клонирования в прокариотическом векторе pJET1.2, и трансфецировать полученные конструкции в клетки Е. coli. В среднем, для проведения одной реакции лигирования ПЦР-продуктов размером более 1000 п.о. использовали от 50 до 100 нг ДНК вектора, для ПЦР-продуктов менее 1000 п.о. - от 20 до 50 нг ДНК вектора. Для трансформации использовали компетентные клетки E. coli штамма DH5α в концентрации 106 в 50 мкл. Прокариотический вектор pJET1.2 подходит для клонирования ПЦР-продуктов, минуя стадию очистки ПЦР-продуктов от реакционной смеси. Использование данного вектора позволяет провести клонирование с возможностью получения до 100% положительных клонов, избавляя от необходимости проведения скрининга колоний. Данный вектор является производной высококопийной плазмиды рUC, которая содержит ген эндонуклеазы, продукт экспрессии которого ограничивает рост бактерий штаммов E.coli, которые обычно используют для клонирования. ДНК полученных клонов была проанализирована в ПЦР на наличие встроек, которые были секвенированы. Для каждого гена были отобраны по 3 клона, содержащие гомологичную встройку. Таким образом, была сконструирована клонотека из 24 клонов для 8 генов вируса АЧС: рекомбинантная плазмида pJET1CD2vKrasnodar06/12 содержит встройку размером 1134 п.о., плазмида pJET1р12Krasnodar06/12 содержит встройку размером 421 п.о. (рисунок 2); плазмида pJET1р22Krasnodar06/12 содержит встройку размером 754 п.о., плазмида pJET1р30Krasnodar06/12 содержит встройку размером 1134 п.о. (рисунок 3); плазмида pJET1р54Krasnodar06/12 содержит встройку размером 717 п.о., плазмида pJET1рр62Krasnodar06/12 содержит встройку размером 1645 п.о. (рисунок 4); плазмида pJET1р72Krasnodar06/12 содержит встройку размером 1981 п.о., плазмида pJET1рр220Krasnodar06/12 содержит встройку размером 1042 п.о. (рисунок 5). А Б Рис. 2. Схема рекомбинантной плазмиды pJET1.2, несущей ген EP402R (А) и ген O61R (Б) вируса АЧС изолята Krasnodar 06/12. Примечание: 1 - изображена встройка клонированного гена; 2 - полилинкер плазмиды pJET1.2; 3 - изображен ген β-лактамазы. В центре изображены название и размер рекомбинантной плазмиды. А Б Рис.3. Схема рекомбинантной плазмиды pJET1.2, несущей ген KP177R (А) и ген CP204L вируса АЧС изолята Krasnodar 06/12. Примечание: 1 - изображена встройка клонированного гена; 2 - полилинкер плазмиды pJET1.2; 3 - изображен ген β-лактамазы. В центре изображены название и размер рекомбинантной плазмиды. А Б Рис. 4. Схема рекомбинантной плазмиды pJET1.2, несущей ген E183L (А) и фрагмент гена CP530R (Б) вируса АЧС изолята Krasnodar 06/12. Примечание: 1 - изображена встройка гена, кодирующего р54; 2 - полилинкер плазмиды pJET1.2; 3 - изображен ген β-лактамазы. В центре изображены название и размер рекомбинантной плазмиды. А Б Рис. 5. Схема рекомбинантной плазмиды pJET1.2, несущей ген B646L (А) и фрагмент гена CP2475L (Б) вируса АЧС изолята Krasnodar 06/12. Примечание: 1 - изображена встройка гена, кодирующего р72; 2 - полилинкер плазмиды pJET1.2; 3 - изображен ген β-лактамазы. В центре изображены название и размер рекомбинантной плазмиды. В результате проведенных работ создана клонотека, которая представляет собой набор генов (B646L, CP204L, KP177R, O61R, EP402R, CP530R, CP2475L и E183L), кодирующих структурные и иммунологически значимые белки вируса АЧС изолята Krasnodar 06/12, клонированных в составе векторной молекулы pJET 1.2. Объем клонированных генов вируса АЧС составляет 5,2% от полноразмерного генома изолята Krasnodar 06/12. Нуклеотидные последовательности генов B646L(p72), CP204L(p30), KP177R, O61R, EP402R, CP530R, CP2475L и E183L вируса АЧС изолята Krasnodar 06/12 опубликованы в GenBank впервые. Анализ нуклеотидных последовательностей клонированных генов показал, что нуклеотидные последовательности полноразмерных генов O61R, KP177R, CP204L, E183L и B646L и фрагментов генов CP530R и CP2475L изолятов Krasnodar 06/12 и Грузия 2007/1 идентичны. Для нуклеотидных последовательностей клонированного фрагмента гена EP402R изолята Krasnodar 06/12 и аналогичного фрагмента изолята Грузия 2007/1 была установлена ~98,2%-ная гомология: были найдены две нуклеотидные замены в положениях нуклеотидов 990 и 994 аденин на цитозин и аденин на тимидин, соответственно. IV.Заключение Неудачи традиционных подходов к созданию вакцины против АЧС, стимулировало развитие других направлений создания средств специфической профилактики, таких как ДНК-вакцинация. Argilaguet J.M. et.al. (2012) показали, что иммунизация сплит-белком содержащим внеклеточный домен CD2v (sHA), p54 и p30, экспоненциально повышает гуморальный и клеточный ответ у свиней [6]. Создание репрезентативных клонотек ДНК последовательностей является эффективным подходом в разработке современных диагностических средств и рекомбинантных вакцин. Таким образом, плазмидные конструкции pJET1CD2vKrasnodar06/12, pJET1р12Krasnodar06/12, pJET1р22Krasnodar06/12, pJET1р30Krasnodar06/12, pJET1р54Krasnodar06/12, pJET1р72Krasnodar06/12, pJET1рр62Krasnodar06/12, pJET1рр220Krasnodar06/12, входящие в состав представленной в данной работе клонотеки, могут быть использованы для определения структуры отдельных генов, создания альтернативных источников генетического материала, как положительный контроль в ПЦР-диагностике, а также для получения рекомбинантных вирусов и ДНК-вакцин.

Научные конференции

 

(c) Архив публикаций научного журнала. Полное или частичное копирование материалов сайта возможно только с письменного разрешения администрации, а также с указанием прямой активной ссылки на источник.